cwlVersion: v1.0 class: Workflow requirements: - class: SubworkflowFeatureRequirement - class: StepInputExpressionRequirement - class: InlineJavascriptRequirement expressionLib: - var get_root = function(basename) { return basename.split('.').slice(0,1).join('.'); }; 'sd:metadata': - "../metadata/rnaseq-header.cwl" 'sd:upstream': genome_indices: "genome-indices.cwl" inputs: # General inputs star_indices_folder: type: Directory label: "STAR indices folder" 'sd:upstreamSource': "genome_indices/star_indices" doc: "Path to STAR generated indices" bowtie_indices_folder: type: Directory label: "BowTie Ribosomal Indices" 'sd:upstreamSource': "genome_indices/ribosomal_indices" doc: "Path to Bowtie generated indices" chrom_length_file: type: File label: "Chromosome length file" format: "http://edamontology.org/format_2330" 'sd:upstreamSource': "genome_indices/chrom_length" doc: "Chromosome length file" annotation_file: type: File label: "Annotation file" format: - "http://edamontology.org/format_2306" - "http://edamontology.org/format_3475" 'sd:upstreamSource': "genome_indices/annotation" doc: "GTF or TAB-separated annotation file" annotation_gtf_file: type: File label: "GTF annotation file" format: "http://edamontology.org/format_2306" 'sd:upstreamSource': "genome_indices/annotation_gtf" doc: "GTF annotation file" fastq_file: type: File label: "FASTQ input file" format: "http://edamontology.org/format_1930" doc: "Reads data in a FASTQ format" # Advanced inputs use_umi: type: boolean? default: true 'sd:layout': advanced: true label: "Use UMIs" doc: "Use UMIs (for FWD-UMI libraries)" exclude_chr: type: string? 'sd:layout': advanced: true label: "Chromosome to be excluded in rpkm calculation" doc: "Chromosome to be excluded in rpkm calculation" clip_3p_end: type: int? default: 0 'sd:layout': advanced: true label: "Clip from 3p end" doc: "Number of bases to clip from the 3p end" clip_5p_end: type: int? default: 0 'sd:layout': advanced: true label: "Clip from 5p end" doc: "Number of bases to clip from the 5p end" minimum_rpkm: type: float? default: 1 label: "Minimum RPKM for Gene Body Average Tag Density Plot" doc: "Minimum RPKM for Gene Body Average Tag Density Plot" 'sd:layout': advanced: true # System dependent threads: type: int? default: 1 'sd:layout': advanced: true label: "Number of threads" doc: "Number of threads for those steps that support multi-threading" outputs: bigwig: type: File format: "http://edamontology.org/format_3006" label: "BigWig file" doc: "Generated BigWig file" outputSource: bam_to_bigwig/bigwig_file 'sd:visualPlugins': - igvbrowser: tab: 'IGV Genome Browser' id: 'igvbrowser' type: 'wig' name: "BigWig Track" height: 120 star_final_log: type: File format: "http://edamontology.org/format_2330" label: "STAR final log" doc: "STAR Log.final.out" outputSource: star_aligner/log_final star_out_log: type: File? format: "http://edamontology.org/format_2330" label: "STAR log out" doc: "STAR Log.out" outputSource: star_aligner/log_out star_progress_log: type: File? format: "http://edamontology.org/format_2330" label: "STAR progress log" doc: "STAR Log.progress.out" outputSource: star_aligner/log_progress star_stdout_log: type: File? format: "http://edamontology.org/format_2330" label: "STAR stdout log" doc: "STAR Log.std.out" outputSource: star_aligner/log_std star_sj_log: type: File? format: "http://edamontology.org/format_2330" label: "STAR sj log" doc: "STAR SJ.out.tab" outputSource: star_aligner/log_sj fastx_statistics: type: File format: "http://edamontology.org/format_2330" label: "FASTQ statistics" doc: "fastx_quality_stats generated FASTQ file quality statistics file" outputSource: fastx_quality_stats/statistics_file 'sd:visualPlugins': - line: tab: 'QC Plots' Title: 'Base frequency plot' xAxisTitle: 'Nucleotide position' yAxisTitle: 'Frequency' colors: ["#b3de69", "#888888", "#fb8072", "#fdc381", "#99c0db"] data: [$13, $14, $15, $16, $17] - boxplot: tab: 'QC Plots' Title: 'Quality Control' xAxisTitle: 'Nucleotide position' yAxisTitle: 'Quality score' colors: ["#b3de69", "#888888", "#fb8072", "#fdc381", "#99c0db"] data: [$11, $7, $8, $9, $12] bambai_pair: type: File format: "http://edamontology.org/format_2572" label: "Coordinate sorted BAM alignment file (+index BAI)" doc: "Coordinate sorted BAM file and BAI index file" outputSource: samtools_sort_index_2/bam_bai_pair 'sd:visualPlugins': - igvbrowser: tab: 'IGV Genome Browser' id: 'igvbrowser' optional: true type: 'alignment' format: 'bam' name: "BAM Track" displayMode: "SQUISHED" bowtie_log: type: File format: "http://edamontology.org/format_2330" label: "Bowtie alignment log" doc: "Bowtie alignment log file" outputSource: bowtie_aligner/log_file # rpkm_isoforms: # type: File # format: "http://edamontology.org/format_3752" # label: "RPKM, grouped by isoforms" # doc: "Calculated rpkm values, grouped by isoforms" # outputSource: rpkm_calculation/isoforms_file rpkm_genes: type: File format: "http://edamontology.org/format_3475" label: "raw reads grouped by gene name" doc: "raw reads grouped by gene name" outputSource: group_isoforms/genes_file 'sd:visualPlugins': - syncfusiongrid: tab: 'Gene Expression' Title: 'raw reads grouped by gene name' htseq_count_report_file: type: File format: "http://edamontology.org/format_3475" label: "HTSeq: read counts grouped by gene_id" doc: "Feature counts from htseq-count grouped by gene_id" outputSource: htseq_count_gene_expression/feature_counts_report_file htseq_count_stdout_log: type: File format: "http://edamontology.org/format_2330" label: "HTSeq: stdout log" doc: "HTSeq: stdout log" outputSource: htseq_count_gene_expression/stdout_log htseq_count_stderr_log: type: File format: "http://edamontology.org/format_2330" label: "HTSeq: stderr log" doc: "HTSeq: stderr log" outputSource: htseq_count_gene_expression/stderr_log rpkm_common_tss: type: File format: "http://edamontology.org/format_3475" label: "raw reads grouped by common TSS" doc: "raw reads grouped by common TSS" outputSource: group_isoforms/common_tss_file get_stat_log: type: File? label: "YAML formatted combined log" format: "http://edamontology.org/format_3750" doc: "YAML formatted combined log" outputSource: get_stat/collected_statistics_yaml get_stat_markdown: type: File? label: "Markdown formatted combined log" format: "http://edamontology.org/format_3835" doc: "Markdown formatted combined log" outputSource: get_stat/collected_statistics_md 'sd:visualPlugins': - markdownView: tab: 'Overview' get_formatted_stats: type: File? label: "Bowtie, STAR and GEEP mapping stats" format: "http://edamontology.org/format_2330" doc: "Processed and combined Bowtie & STAR aligner and GEEP logs" outputSource: get_stat/collected_statistics_tsv 'sd:visualPlugins': - tableView: vertical: true tab: 'Overview' 'sd:preview': 'sd:visualPlugins': - pie: colors: ['#b3de69', '#99c0db', '#fdc381', '#fb8072', '#778899'] data: [$2, $3, $4, $5, $6] bam_statistics_report: type: File label: "BAM statistics report" format: "http://edamontology.org/format_2330" doc: "BAM statistics report (right after alignment and sorting)" outputSource: get_bam_statistics/log_file trim_report: type: File label: "cutadapt report" doc: "cutadapt generated log" outputSource: umisep_cutadapt/report_file umi_tools_dedup_stdout: type: File label: "umi_tools dedup stdout log" doc: "umi_tools dedup stdout log" outputSource: umi_tools_dedup/stdout_log umi_tools_dedup_stderr: type: File label: "umi_tools dedup stderr log" doc: "umi_tools dedup stderr log" outputSource: umi_tools_dedup/stderr_log umi_tools_dedup_stats: type: - "null" - File[] label: "umi_tools dedup stats" doc: "umi_tools dedup stats" outputSource: umi_tools_dedup/output_stats # trim_report: # type: File # label: "TrimGalore report" # doc: "TrimGalore generated log" # outputSource: trim_fastq/report_file gene_body_report: type: File? format: "http://edamontology.org/format_3475" label: "Gene body average tag density plot for all isoforms longer than 1000 bp" doc: "Gene body average tag density plot for all isoforms longer than 1000 bp in TSV format" outputSource: get_gene_body/gene_body_report_file 'sd:visualPlugins': - line: tab: 'QC Plots' Title: 'Gene body average tag density plot' xAxisTitle: "Gene body percentile (5' -> 3')" yAxisTitle: "Average Tag Density (per percentile)" colors: ["#232C15"] data: [$2] comparable: "gbatdp" gene_body_plot_pdf: type: File? format: "http://edamontology.org/format_3508" label: "Gene body average tag density plot for all isoforms longer than 1000 bp" doc: "Gene body average tag density plot for all isoforms longer than 1000 bp in PDF format" outputSource: get_gene_body/gene_body_plot_pdf rpkm_distribution_plot_pdf: type: File? format: "http://edamontology.org/format_3508" label: "RPKM distribution plot for isoforms" doc: "RPKM distribution plot for isoforms in PDF format" outputSource: get_gene_body/rpkm_distribution_plot_pdf steps: extract_fastq: run: ../tools/extract-fastq.cwl in: compressed_file: fastq_file out: [fastq_file] # trim_fastq: # run: ../tools/trimgalore.cwl # in: # input_file: extract_fastq/fastq_file # dont_gzip: # default: true # length: # default: 30 # out: # - trimmed_file # - report_file umisep_cutadapt: in: input_file: extract_fastq/fastq_file trigger: use_umi out: - trimmed_file - report_file run: cwlVersion: v1.0 class: CommandLineTool hints: - class: DockerRequirement dockerPull: scidap/trimgalore:v0.6.6 inputs: bash_script: type: string? default: | #!/bin/bash FILE=$1 BASENAME=$(basename "$FILE") if [ "$0" = "true" ]; then cat ${FILE} | awk ' NR%4==1{ rd_name=$1; rd_info=$2 } NR%4==2{ umi=substr($1,1,10); rd_seq=substr($1,11) } NR%4==0{ print rd_name"_"umi" "rd_info; print rd_seq; print "+"; print substr($1,11) }' | cutadapt -m 20 -O 20 -a "polyA=A{20}" -a "QUALITY=G{20}" -n 2 - | cutadapt -m 20 -O 3 --nextseq-trim=10 -a "r1adapter=A{18}AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=3;max_error_rate=0.100000" - | cutadapt -m 20 -O 3 -a "r1polyA=A{18}" - | cutadapt -m 20 -O 20 -g "r1adapter=AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC;min_overlap=20" --discard-trimmed -o trimmed_${BASENAME} - else cp ${FILE} trimmed_${BASENAME} fi inputBinding: position: 1 doc: | Bash function to run awk & cutadapt from Lexogen with all input parameters or skip it if trigger is false trigger: type: boolean? default: true inputBinding: position: 2 valueFrom: $(self?"true":"false") input_file: type: - File inputBinding: position: 3 doc: | Input FASTQ file outputs: trimmed_file: type: File outputBinding: glob: "trimmed_*" report_file: type: stderr baseCommand: [bash, '-c'] stderr: umisep_cutadapt.log rename: run: ../tools/rename.cwl in: source_file: umisep_cutadapt/trimmed_file target_filename: source: extract_fastq/fastq_file valueFrom: $(self.basename) out: - target_file star_aligner: run: ../tools/star-alignreads.cwl in: readFilesIn: rename/target_file genomeDir: star_indices_folder outFilterMultimapNmax: default: 1 outFilterMismatchNmax: default: 5 alignSJDBoverhangMin: default: 1 seedSearchStartLmax: default: 15 clip3pNbases: clip_3p_end clip5pNbases: clip_5p_end threads: threads out: - aligned_file - log_final - uniquely_mapped_reads_number - log_out - log_progress - log_std - log_sj fastx_quality_stats: run: ../tools/fastx-quality-stats.cwl in: input_file: rename/target_file out: [statistics_file] samtools_sort_index_1: run: ../tools/samtools-sort-index.cwl in: sort_input: star_aligner/aligned_file sort_output_filename: source: rename/target_file valueFrom: $(self.location.split('/').slice(-1)[0].split('.').slice(0,-1).join('.')+'.bam') threads: threads out: [bam_bai_pair] umi_tools_dedup: run: ../tools/umi-tools-dedup.cwl in: bam_file: samtools_sort_index_1/bam_bai_pair multimapping_detection_method: default: "NH" trigger: use_umi out: [dedup_bam_file, stdout_log, stderr_log, output_stats] samtools_sort_index_2: run: ../tools/samtools-sort-index.cwl in: sort_input: umi_tools_dedup/dedup_bam_file sort_output_filename: source: rename/target_file valueFrom: $(self.location.split('/').slice(-1)[0].split('.').slice(0,-1).join('.')+'.bam') threads: threads out: [bam_bai_pair] bam_to_bigwig: run: ../tools/bam-bedgraph-bigwig.cwl in: bam_file: samtools_sort_index_2/bam_bai_pair chrom_length_file: chrom_length_file mapped_reads_number: star_aligner/uniquely_mapped_reads_number # fragmentsize is not set (STAR gives only read length). It will be calculated automatically by bedtools genomecov. out: [bigwig_file] bowtie_aligner: run: ../tools/bowtie-alignreads.cwl in: upstream_filelist: rename/target_file indices_folder: bowtie_indices_folder clip_3p_end: clip_3p_end clip_5p_end: clip_5p_end v: default: 3 m: default: 1 best: default: true strata: default: true sam: default: true threads: threads out: [log_file] rpkm_calculation: run: ../tools/geep.cwl in: bam_file: samtools_sort_index_2/bam_bai_pair annotation_file: annotation_file rpkm_threshold: default: 0 max_cycles: default: 0 exclude_chr: exclude_chr threads: threads out: [isoforms_file] group_isoforms: in: isoforms_file: rpkm_calculation/isoforms_file out: - genes_file - common_tss_file - error_file run: cwlVersion: v1.0 class: CommandLineTool hints: - class: DockerRequirement dockerPull: biowardrobe2/scidap-deseq:v0.0.20 inputs: bash_script: type: string? default: | #!/bin/bash FILE=$0 BASENAME=$(basename "$FILE") get_gene_n_tss.R --isoforms "${FILE}" --gene grouped.genes.tsv --tss grouped.common_tss.tsv sed -ibak 's/[[:space:]]\{1,\}[^[:space:]]\{1,\}$//' grouped.genes.tsv sed -ibak 's/[[:space:]]\{1,\}[^[:space:]]\{1,\}$//' grouped.common_tss.tsv rm -f ./*bak inputBinding: position: 1 doc: | Bash function to run awk & cutadapt from Lexogen with all input parameters or skip it if trigger is false isoforms_file: type: File inputBinding: position: 5 outputs: genes_file: type: File outputBinding: glob: $(inputs.genes_filename?inputs.genes_filename:"*genes.tsv") doc: "Output TSV gene expression file" common_tss_file: type: File outputBinding: glob: $(inputs.common_tss_file?inputs.common_tss_file:"*common_tss.tsv") doc: "Output TSV common tss expression file" error_file: type: stderr baseCommand: [bash, '-c'] stderr: group_isoforms_error.log get_bam_statistics: run: ../tools/samtools-stats.cwl in: bambai_pair: samtools_sort_index_2/bam_bai_pair output_filename: source: samtools_sort_index_2/bam_bai_pair valueFrom: $(get_root(self.basename)+"_bam_statistics_report.txt") out: [log_file] get_stat: run: ../tools/collect-statistics-rna-quantseq.cwl in: # trimgalore_report_fastq_1: trim_fastq/report_file star_alignment_report: star_aligner/log_final bowtie_alignment_report: bowtie_aligner/log_file bam_statistics_report: get_bam_statistics/log_file isoforms_file: rpkm_calculation/isoforms_file out: [collected_statistics_yaml, collected_statistics_tsv, collected_statistics_md] htseq_count_gene_expression: run: ../tools/htseq-count.cwl in: alignment_bam_file: samtools_sort_index_2/bam_bai_pair annotation_gtf_file: annotation_gtf_file strand_specific: default: "yes" feature_type: default: "exon" feature_id: default: "gene_id" additional_id: default: "transcript_id" out: - feature_counts_report_file - stdout_log - stderr_log get_gene_body: run: ../tools/plugin-plot-rna.cwl in: annotation_file: annotation_file bambai_pair: samtools_sort_index_2/bam_bai_pair isoforms_file: rpkm_calculation/isoforms_file mapped_reads_number: star_aligner/uniquely_mapped_reads_number minimum_rpkm: minimum_rpkm strand_specificity: default: "no" threads: threads out: - gene_body_report_file - gene_body_plot_pdf - rpkm_distribution_plot_pdf $namespaces: s: http://schema.org/ $schemas: - https://github.com/schemaorg/schemaorg/raw/main/data/releases/11.01/schemaorg-current-http.rdf s:name: "QuantSeq 3' mRNA-Seq single-read" label: "QuantSeq 3' mRNA-Seq single-read" s:alternateName: "Run QuantSeq 3' mRNA-Seq basic analysis with single-end data file" s:downloadUrl: https://raw.githubusercontent.com/datirium/workflows/master/workflows/trim-quantseq-mrnaseq-se.cwl s:codeRepository: https://github.com/datirium/workflows s:license: http://www.apache.org/licenses/LICENSE-2.0 s:isPartOf: class: s:CreativeWork s:name: Common Workflow Language s:url: http://commonwl.org/ s:creator: - class: s:Organization s:legalName: "Datirium, LLC" s:member: - class: s:Person s:name: Artem Barski s:email: mailto:Artem.Barski@datirum.com - class: s:Person s:name: Andrey Kartashov s:email: mailto:Andrey.Kartashov@datirium.com s:sameAs: - id: http://orcid.org/0000-0001-9102-5681 # doc: # $include: ../descriptions/trim-quantseq-mrnaseq-se.md doc: | ### Pipeline for Lexogen's QuantSeq 3' mRNA-Seq Library Prep Kit FWD for Illumina [Lexogen original documentation](https://www.lexogen.com/quantseq-3mrna-sequencing/) * Cost-saving and streamlined globin mRNA depletion during QuantSeq library preparation * Genome-wide analysis of gene expression * Cost-efficient alternative to microarrays and standard RNA-Seq * Down to 100 pg total RNA input * Applicable for low quality and FFPE samples * Single-read sequencing of up to 9,216 samples/lane * Dual indexing and Unique Molecular Identifiers (UMIs) are available ### QuantSeq 3’ mRNA-Seq Library Prep Kit FWD for Illumina The QuantSeq FWD Kit is a library preparation protocol designed to generate Illumina compatible libraries of sequences close to the 3’ end of polyadenylated RNA. QuantSeq FWD contains the Illumina Read 1 linker sequence in the second strand synthesis primer, hence NGS reads are generated towards the poly(A) tail, directly reflecting the mRNA sequence (see workflow). This version is the recommended standard for gene expression analysis. Lexogen furthermore provides a high-throughput version with optional dual indexing (i5 and i7 indices) allowing up to 9,216 samples to be multiplexed in one lane. #### Analysis of Low Input and Low Quality Samples The required input amount of total RNA is as low as 100 pg. QuantSeq is suitable to reproducibly generate libraries from low quality RNA, including FFPE samples. See Fig.1 and 2 for a comparison of two different RNA qualities (FFPE and fresh frozen cryo-block) of the same sample. ![Fig 1](https://www.lexogen.com/wp-content/uploads/2017/02/Correlation_Samples.jpg) Figure 1 | Correlation of gene counts of FFPE and cryo samples. ![Fig 2](https://www.lexogen.com/wp-content/uploads/2017/02/Venn_diagrams.jpg) Figure 2 | Venn diagrams of genes detected by QuantSeq at a uniform read depth of 2.5 M reads in FFPE and cryo samples with 1, 5, and 10 reads/gene thresholds. #### Mapping of Transcript End Sites By using longer reads QuantSeq FWD allows to exactly pinpoint the 3’ end of poly(A) RNA (see Fig. 3) and therefore obtain accurate information about the 3’ UTR. ![Figure 3](https://www.lexogen.com/wp-content/uploads/2017/02/Read_Coverage.jpg) Figure 3 | QuantSeq read coverage versus normalized transcript length of NGS libraries derived from FFPE-RNA (blue) and cryo-preserved RNA (red). ### Current workflow should be used only with the single-end RNA-Seq data. It performs the following steps: 1. Separates UMIes and trims adapters from input FASTQ file 2. Uses ```STAR``` to align reads from input FASTQ file according to the predefined reference indices; generates unsorted BAM file and alignment statistics file 3. Uses ```fastx_quality_stats``` to analyze input FASTQ file and generates quality statistics file 4. Uses ```samtools sort``` and generates coordinate sorted BAM(+BAI) file pair from the unsorted BAM file obtained on the step 2 (after running STAR) 5. Uses ```umi_tools dedup``` and generates final filtered sorted BAM(+BAI) file pair 6. Generates BigWig file on the base of sorted BAM file 7. Maps input FASTQ file to predefined rRNA reference indices using ```bowtie``` to define the level of rRNA contamination; exports resulted statistics to file 8. Calculates isoform expression level for the sorted BAM file and GTF/TAB annotation file using GEEP reads-counting utility; exports results to file